Национальный цифровой ресурс Руконт - межотраслевая электронная библиотека (ЭБС) на базе технологии Контекстум (всего произведений: 560034)
Консорциум Контекстум Информационная технология сбора цифрового контента
Уважаемые СТУДЕНТЫ и СОТРУДНИКИ ВУЗов, использующие нашу ЭБС. Рекомендуем использовать новую версию сайта.
  Расширенный поиск
Результаты поиска

Нашлось результатов: 61207 (0,87 сек)

Свободный доступ
Ограниченный доступ
Уточняется продление лицензии
1

МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКАЯ ХАРАКТЕРИСТИКА НЕМЕЛКОКЛЕТОЧНОГО РАКА ЛЕГКОГО С ИСПОЛЬЗОВАНИЕМ МЕТОДА МУЛЬТИТАРГЕТНОЙ ОДНОНУКЛЕОТИДНОЙ ЭЛОНГАЦИИ И ФРАГМЕНТНОГО АНАЛИЗА [Электронный ресурс] / Мусаелян [и др.] // Молекулярная медицина .— 2020 .— №3 .— С. 50-56 .— Режим доступа: https://rucont.ru/efd/738518

Автор: Мусаелян

Введение. Рак легкого – наиболее частая причина смерти при злокачественных новообразованиях. Преобладающим типом является немелкоклеточный рак легкого (НМКРЛ), при лечении которого активно применяется таргетная терапия тирозинкиназными ингибиторами (ТКИ) EGFR, а также комбинация BRAF/MEK ингибиторов. Показанием для данной терапии является генотипирование опухолевого материала для обнаружения предиктивных маркеров, таких как мутации в генах EGFR, KRAS, BRAF и HER2. Одним из подходов к быстрому и комплексному выявлению аббераций в генах интереса является использование методов мультитаргетной однонуклеотидной элонгации (МОЭ) и фрагментного анализа (ФА), обладающих высокой чувствительностью. Цель. Определение клинико-морфологических характеристик у пациентов с НМКРЛ с наличием драйверных мутаций в генах EGFR, KRAS, BRAF и HER2. Материал и методы. На базе ПСПбГМУ им. И.П. Павлова был организован криобанк биологических материалов, взятых у пациентов с НМКРЛ. Для генотипирования центральных участков опухолевых образцов у 60 пациентов с НМКРЛ использовались методы МОЭ и ФА. Результаты. Мутации в гене EGFR обнаружены исключительно у пациентов с аденокарциномой легкого (p=0,0008) с частотой 31%. Данные аберрации статистически значимо ассоциированы с женским полом (p=0,0002) и отсутствием статуса курения (p=0,0007). Соотношение делеции в 19 экзоне к точечной мутации L858R составило 2,5:1. Распространенность минорных мутаций у EGFR-положительных пациентов достигала 22,2%. При этом у одного пациента было выявлено сосуществование минорных мутаций G719S и S768I. Причиной приобретенной резистентности к ТКИ EGFR 1-го поколения у пациента явилась делеция в 19 экзоне-T790M в гене EGFR, возникшая на фоне лечения. Аберрации в гене KRAS обнаружены у 10% пациентов мужского пола с НМКРЛ, ранее куривших или продолжающих курить. Мутация V600E в гене BRAF и инсерции в гене HER2 не обнаружены. Заключение. Применение комплексного методического подхода позволяет с высокой точностью определять клинически значимые аберрации в гене EGFR, KRAS, BRAF и HER2 у пациентов c НМКРЛ в соответствии с клиническими рекомендациями.

Мутация V600E в гене BRAF и инсерции в гене HER2 не обнаружены. Заключение. <...> Мутации в гене HER2, в частности инсерции в 20 экзоне, и в гене BRAF ассоциированы с устойчивостью к <...> EGFR; в 12, 13 кодонах 2 экзона и в 61 кодоне 3 экзона гена KRAS; в 15 экзоне гена BRAF (табл. 2). <...> , V600E в гене BRAF были созданы 3 панели с помощью МОЭ. <...> По литературным данным, мутации в гене HER2, в частности инсерции в 20 экзоне, и в гене BRAF встречаются

2

МУТАНТНЫЙ СТАТУС И НЕКОТОРЫЕ КЛИНИКО-МОРФОЛОГИЧЕСКИЕ ОСОБЕННОСТИ МЕЛАНОМЫ КОЖИ [Электронный ресурс] / Мазуренко [и др.] // Российский онкологический журнал .— 2017 .— №2 .— С. 8-13 .— Режим доступа: https://rucont.ru/efd/594428

Автор: Мазуренко

Меланома кожи характеризуется молекулярной гетерогенностью. Работа посвящена анализу мутаций генов, активирующих MAPK-сигнальный путь (mitogen-activated proteinkinase – митогенактивируемая протеинкиназа), в образцах первичной и метастатической меланомы кожи с целью определения чувствительности к препаратам таргетной терапии и выявления возможной ассоциации генетических данных с некоторыми клинико-морфологическими характеристиками пациентов. Мутации генов BRAF, NRAS и KIT выявлены соответственно в 60,6; 13,8 и 1% случаев меланомы кожи. Мутантный статус меланомы различался в зависимости от локализации опухоли, хронической УФ-инсоляции и возраста пациента. Так, частота мутаций BRAF в меланоме туловища и конечностей (64,7%) выше, чем в меланоме лица и головы (42,8%). Показано, что частота мутации BRAF не зависит от пигментации и фазы роста меланомы. В то же время частота мутации NRAS ниже в беспигментных и выше в узловых меланомах, чем в пигментированных поверхностно-распространяющихся меланомах. Впервые показана ассоциация мутантного статуса с определенным гистологическим типом опухоли; наиболее высокая частота мутаций BRAF выявлена в эпителиоидноклеточной меланоме. Полученные результаты важны для лечения метастатической меланомы кожи, поскольку мутантный статус определяет чувствительность к таргетной терапии пациентов с мутациями BRAF, NRAS и KIT

Работа посвящена анализу мутаций генов, активирующих MAPK-сигнальный путь (mitogen-activated proteinkinase <...> Мутации генов BRAF, NRAS и KIT выявлены соответственно в 60,6; 13,8 и 1% случаев меланомы кожи. <...> В настоящей работе представлены результаты анализа мутаций генов BRAF, NRAS и KIT в образцах первичной <...> У белых американцев гены BRAF и NRAS дикого типа присутствуют в 31,1% меланомы, тогда как у пациентов <...> В нашем исследовании гены BRAF и NRAS дикого типа обнаружены в меланоме у 25% пациентов.

3

№1 [Эндокринная хирургия, 2019]

научно-практический журнал, издается 2007 г. Главный редактор - профессор, д.м.н. Кузнецов Н.С. Журнал Эндокринная хирургия - первое в России периодическое издание, посвященное проблемам диагностики и хирургического лечения различных заболеваний эндокринной системы. В данном научно-практическом издании рассматриваются медико-технические вопросы хирургических подходов к лечению не только эндокринных заболеваний, но и проблемы хирургического лечения осложнений сахарного диабета, в частности синдрома диабетической стопы, диабетической офтальмопатии и т.д.

Мутации в “горячих точках” гена BRAF (экзон 15, район кодонов 600–601) были обнаружены у 29 пациентов <...> BRAF и 0% для гена NRAS. <...> активирующие соматические мутации в этом гене, которые чаще всего локализуются в 15-м экзоне гена BRAF <...> Поиск мутаций в “горячих точках” экзона 15 гена BRAF и экзона 3 гена NRAS в образцах циркулирующей ДНК <...> Мутации в гене BRAF в образцах плазмы крови не были выявлены ни в одном случае, мутации в гене NRAS в

Предпросмотр: Эндокринная хирургия №1 2019.pdf (0,2 Мб)
4

№2 [Эндокринная хирургия, 2019]

научно-практический журнал, издается 2007 г. Главный редактор - профессор, д.м.н. Кузнецов Н.С. Журнал Эндокринная хирургия - первое в России периодическое издание, посвященное проблемам диагностики и хирургического лечения различных заболеваний эндокринной системы. В данном научно-практическом издании рассматриваются медико-технические вопросы хирургических подходов к лечению не только эндокринных заболеваний, но и проблемы хирургического лечения осложнений сахарного диабета, в частности синдрома диабетической стопы, диабетической офтальмопатии и т.д.

Мутации в “горячих точках” гена BRAF (экзон 15, район кодонов 600–601) были обнаружены у 53 пациентов <...> Мутации гена BRAF чаще всего локализуются в 15-м экзоне гена BRAF (кодоны 600–601), реже встречаются <...> “неклассические” мута ции в 11-м и 15-м экзонах гена BRAF (в районе кодонов 469, 570–598, 603– 605) [ <...> Данные исследований влияния мутации в гене BRAF на прогноз свидетельствуют о том, что в целом BRAF V600E-позитивные <...> Таким образом, частота Встречаемость соматических мутаций в “горячих точках” генов BRAF, KRAS, NRAS,

Предпросмотр: Эндокринная хирургия №2 2019.pdf (0,2 Мб)
5

№2 [Клиническая и экспериментальная тиреоидология, 2016]

Современнные проблемы клинической и экспериментальной тиреоидологии: этиология, патогенез, принципы диагностики, лечения и профилактики заболеваний щитовидной железы

Таким образом, изме нение активности генов BRAF, RAS, RET может приводить к конститутивной трансдукции <...> Точковые мутации Точковые мутации в гене BRAF обнаруживаются, по данным разных авторов, в 40–60% ПРЩЖ <...> BRAF. <...> В ряде случаев гиперметилирование было ассоциировано с наличием драйверных мутаций в генах BRAF, RAS, <...> Панель, включающая мутации 7 (или 8) генов (BRAF, KRAS, HRAS, NRAS, RET/PTC1, RET/PTC3, PAX8/PPARγ, (

Предпросмотр: Клиническая и экспериментальная тиреоидология №2 2016.pdf (0,2 Мб)
6

№6 [Проблемы эндокринологии, 2019]

В свободно циркулирующей ДНК плазмы крови мутации гена BRAF были выявлены в 1 случае, мутации гена NRAS <...> Поиск мутаций в «горячих точках» экзона 15 гена BRAF и экзона 3 гена NRAS в образцах сцДНК плазмы крови <...> Мутации гена BRAF чаще всего локализуются в 15-м экзоне гена BRAF (кодоны 600-601), реже встречаются <...> Данные исследований прогностической значимости мутаций гена BRAF свидетельствуют о том, что в целом BRAF <...> В нашем исследовании частота выявленных мутаций в гене BRAF и в гене NRAS в сцДНК плазмы крови составило

Предпросмотр: Проблемы эндокринологии №6 2019.pdf (0,4 Мб)
7

№3 [Молекулярная медицина, 2020]

Включен в перечень ВАК.

Мутация V600E в гене BRAF и инсерции в гене HER2 не обнаружены. Заключение. <...> Мутации в гене HER2, в частности инсерции в 20 экзоне, и в гене BRAF ассоциированы с устойчивостью к <...> EGFR; в 12, 13 кодонах 2 экзона и в 61 кодоне 3 экзона гена KRAS; в 15 экзоне гена BRAF (табл. 2). <...> , V600E в гене BRAF были созданы 3 панели с помощью МОЭ. <...> По литературным данным, мутации в гене HER2, в частности инсерции в 20 экзоне, и в гене BRAF встречаются

Предпросмотр: Молекулярная медицина №3 2020.pdf (0,1 Мб)
8

№2 [Российский онкологический журнал, 2017]

Основан в 1996 г. Главный редактор журнала - Лазарев Александр Федорович - доктор медицинский наук, профессор, директор Алтайского филиала ФГБУ «Российский онкологический научный центр им. Н.Н.Блохина» Минздрава России. В оригинальных и обзорных статьях журнал освещает современные научные достижения в области клинической и экспериментальной онкологии, практические проблемы диагностики, комбинированного и комплексного лечения злокачественных новообразований, вопросы научной организации противораковой борьбы, опыта работы практических онкологических учреждений. Публикует данные о внедрении научных достижений в практику и обмен опытом. Информирует о состоянии науки за рубежом, печатает статьи, обзоры, обобщающие научные данные по важнейшим теоретическим и практическим проблемам, истории онкологии, хронику.

Мутации генов BRAF, NRAS и KIT выявлены соответственно в 60,6; 13,8 и 1% случаев меланомы кожи. <...> В настоящей работе представлены результаты анализа мутаций генов BRAF, NRAS и KIT в образцах первичной <...> У белых американцев гены BRAF и NRAS дикого типа присутствуют в 31,1% меланомы, тогда как у пациентов <...> В нашем исследовании гены BRAF и NRAS дикого типа обнаружены в меланоме у 25% пациентов. <...> BRAF.

Предпросмотр: Российский онкологический журнал №2 2017.pdf (1,0 Мб)
9

№3 [Архив патологии, 2020]

Журнал основан в 1935 году, является одним из старейших периодических медицинских изданий в России. В нем публикуются оригинальные исследования по актуальным вопросам патологической анатомии и общей патологии, освещающие важнейшие положения теории и практики различных болезней человека (онкология, инфекционные болезни, заболевания сердца и сосудов, нефропатология, профессиональная патология, гастроэнтерология и др.), а также экспериментальной и географической патологии. Для ознакомления широкого круга читателей с новейшими достижениями отечественной и зарубежной медицины регулярно публикуются передовые и обзорные статьи, рецензии на наиболее интересные отечественные и зарубежные книги, новые данные о современных методах исследования в морфологии и молекулярной биологии (иммуногистохимия, электронная микроскопия, полимеразная цепная реакция и др.). Освещаются вопросы организации патологической службы, преподавания патологической анатомии. Регулярно печатаются статьи по истории патологической анатомии, помещаются отчеты о работе научных обществ патологоанатомов, сообщения о симпозиумах и совещаниях. Журнал рассчитан на патологоанатомов, патофизиологов, судебных медиков, а также клиницистов. Журнал входит в перечень изданий, утвержденных ВАК для публикаций материалов кандидатских и докторских диссертаций. Издание включено в Перечень автоматически, т.к. индексируется в международных базах данных.

Эти раки характеризуются частыми мутациями гена BRAF, метиляторным фенотипом, низкими SCNA, выраженным <...> BRAF. <...> Мутации гена BRAF (чаще в районе 600-й аминокислоты, V600E) сопряжены с неблагоприятным прогнозом, используются <...> Микросателлитная нестабильность, ассоциированная с геном BRAF дикого типа, является предиктором хорошего <...> ACVR2A (60%), APC (50%), TGFBR2 (50%), BRAF (45%), MSH3 (40%), MSH6 (40%), MYO1B (30%), TCF7L2 (30%)

Предпросмотр: Архив патологии №3 2020.pdf (0,4 Мб)
10

№4 [Современные технологии в медицине, 2020]

Рецензируемый научно-практический журнал. Публикует статьи по следующим направлениям: морфология, физиология, медицинская физика, внутренние болезни, хирургия, лучевая диагностика, педиатрия, неврология, медицинская фармакология. В журнале публикуются оригинальные статьи, статьи по новым методам диагностики и лечения, краткие сообщения, обзоры, лекции, описания клинических случаев. Все представленные материалы рецензируются и обсуждаются редакционной коллегией.

Молекулярно-генетический анализ мутационного статуса генов RAS-каскада KRAS, NRAS и BRAF имеет важное <...> Ген BRAF кодирует внутриклеточный белок, который является компонентом сигнальных каскадов RAS–MAPK и <...> Наиболее частой активирующей мутацией гена BRAF является точечная нуклеотидная замена, которая в 95% <...> Отмечена связь наличия мутации в гене BRAF и состояния системы репарации неспаренных оснований ДНК. <...> Пер спективы лечения больных раком толстой кишки с мутацией в гене BRAF.

Предпросмотр: Современные технологии в медицине №4 2020.pdf (0,7 Мб)
11

МУТАЦИЯ BRAF V600E ПРИ ПАПИЛЛЯРНОМ РАКЕ ЩИТОВИДНОЙ ЖЕЛЕЗЫ, КЛИНИКО-МОРФОЛОГИЧЕСКИЕ ПАРАЛЛЕЛИ И ПРОГНОЗ [Электронный ресурс] / Иванов [и др.] // Российский онкологический журнал .— 2017 .— №1 .— С. 17-22 .— Режим доступа: https://rucont.ru/efd/576880

Автор: Иванов

Авторами на материале 67 случаев папиллярного рака щитовидной железы (ПРЩЖ) проведено исследование взаимосвязи мутации BRAF V600E c прогнозом, биомолекулярными и клинико-морфологическими характеристиками заболевания. Проводился анализ образцов на наличие 7 мутаций гена KRAS, 4 мутаций гена PIK3CA, мутации BRAF V600E с выявлением взаимосвязи с биомолекулярными маркерами пролиферации и апоптоза Ki-67, p53, Bcl-2. Также проводили хромогенную гибридизацию in situ (метод CISH) для исследования статуса гена HER2. Определяли взаимосвязь мутации V600E гена BRAF с клиническими показателями прогноза: размерами опухоли, инвазией в капсулу, наличием метастазов в регионарных лимфоузлах. Кроме того, оценивали взаимосвязь BRAF V600E с 10-летней выживаемостью.

Проводился анализ образцов на наличие 7 мутаций гена KRAS, 4 мутаций гена PIK3CA, мутации BRAF V600E <...> Определяли взаимосвязь мутации V600E гена BRAF с клиническими показателями прогноза: размерами опухоли <...> Мутации в генах KRAS, PIK3CA не выявлены. Мутация V600E в гене BRAF выявлена в 50 (75%)случаях. <...> Val600Glu в гене BRAF выявлена в 50 (75%) случаях. <...> активности до 5,4% составило 81 ± 7,2%, а при диком типе гена BRAF – 44 ± 28,7%.

12

СОМАТИЧЕСКИЕ МУТАЦИИ В ГЕНАХ BRAF, KRAS, NRAS, EIF1AX И TERT: ДИАГНОСТИЧЕСКАЯ ЗНАЧИМОСТЬ ПРИ НОВООБРАЗОВАНИЯХ ЩИТОВИДНОЙ ЖЕЛЕЗЫ [Электронный ресурс] / Качко [и др.] // Бюллетень экспериментальной биологии и медицины .— 2020 .— №5 .— С. 600-603 .— Режим доступа: https://rucont.ru/efd/718803

Автор: Качко

Целесообразность использования молекулярно-генетических маркеров, ассоциированных с раком щитовидной железы и более агрессивным течением заболевания, остаётся предметом активных исследований. Оценивали диагностическую значимость соматических мутаций в “горячих точках” генов BRAF, KRAS, NRAS, EIF1AX и TERT в гистологическом материале 153 пациентов с новообразованиями щитовидной железы. Мутации в гене BRAF (экзон 15, район кодонов 600-601) были обнаружены у 54 пациентов, в гене NRAS (экзон 3, кодон 61) — у 12 пациентов. Мутации генов KRAS, TERT и EIF1AX выявлены не были.

Оценивали диагностическую значимость сома� тических мутаций в “горячих точках” генов BRAF, KRAS, NRAS <...> Мутации в гене BRAF (экзон 15, район кодонов 600�601) были обнаружены у 54 пациентов, в гене NRAS (экзон <...> Ключевые слова: новообразования щитовидной железы; мутации генов BRAF, KRAS, NRAS, EIF1AX, TERT Адрес <...> РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ Поиск мутаций в “горячих точках” гена BRAF (экзо� на 15, район кодонов 600�601 <...> Мутации гена BRAF в 53 случаях гистологичес� ки были представлены папиллярным РЩЖ.

13

Индивидуализация подхода в лечении сарком мягких тканей – последовательная таргетная терапия альвеолярной саркомы [Электронный ресурс] / Лазарева // Евразийский онкологический журнал .— 2016 .— №2 .— С. 141-142 .— Режим доступа: https://rucont.ru/efd/479332

Автор: Лазарева

Саркомы мягких тканей (СМТ) – это редко встречающиеся опухоли, составляющие около 1% от всех злокачественных новообразований. Часто данная патология встречается в молодом возрасте. На современном этапе увеличилось понимание биологических различий между подтипами, связанное с их генетическими особенностями.

BRAF с клиникоморфологическими особенностями меланомы кожи Мутации в гене BRAF наблюдаются в 40–80% <...> На сегодняшний день известно около 40 соматических мутаций в гене BRAF. <...> Молекулярно-генетическое исследование 15-го экзона гена BRAF проведено методами прямого секвенирования <...> Установлена статистически достоверная связь (p<0,05) между наличием активирующей мутации V600 гена BRAF <...> ДНК по Сэнгеру и RT-ПЦР) нами установлены два варианта мутаций в 15-м экзоне гена BRAF: p.V600E и p.V600K

14

№4 [Клиническая и экспериментальная тиреоидология, 2009]

Современнные проблемы клинической и экспериментальной тиреоидологии: этиология, патогенез, принципы диагностики, лечения и профилактики заболеваний щитовидной железы

Пестерова Значение выявления мутации гена BRAF в дооперационной диагностике рака щитовидной железы . <...> TACAGT+3’ для дикого типа и FM+BRAF 5’+GGT+ GATTTTGGTCTAGCTACAAA+3’ для мутантного типа гена [22]. <...> Дорожки 1, 2, 3, 4 – “дикий” и мутантный тип гена BRAF. <...> 8 – мутант+ ный тип гена BRAF. <...> BRAF определялся в 15 (79%) образцах, а в 4 случаях мутантный тип гена BRAF не определялся.

Предпросмотр: Клиническая и экспериментальная тиреоидология №4 2009.pdf (0,3 Мб)
15

ПРИМЕНЕНИЕ МЕТОДОВ СЕКВЕНИРОВАНИЯ В ДЕРМАТОЛОГИИ [Электронный ресурс] / Аксененко, Рукша // Российский журнал кожных и венерических болезней .— 2016 .— №1 .— С. 9-14 .— Режим доступа: https://rucont.ru/efd/399931

Автор: Аксененко

Обзор литературы посвящен применению методов секвенирования (метода исследования генома) при различных дерматологических заболеваниях. В статье описаны технологии, позволяющие установить нуклеотидную последовательность ДНК. Рассмотрен способ автоматизированного секвенирования по Сенгеру, а также секвенирование нового поколения (Next-Generation Sequencing). Приведены примеры генов и мутаций, которые были обнаружены при помощи секвенирования. В частности, описано клиническое значение мутаций в генах BRAF, NRAS, KIT, GNAQ, GNA11, каждая из которых играет решающую роль в патогенезе отдельных клинико-морфологических форм меланомы кожи. Показано, что выявление подтипов опухоли обеспечивает селективный подход в терапии меланомы кожи, что, в свою очередь, может быть применено при различных принципах лечения и дает возможность для прогнозирования развития химиорезистентности. Кроме того, представлены данные о других генах, играющих роль в патогенезе отдельных дерматологических заболеваний как опухолевого, так и неопухолевого генеза.

В частности, описано клиническое значение мутаций в генах BRAF, NRAS, KIT, GNAQ, GNA11, каждая из которых <...> Мутации в гене BRAF затрагивают, как правило, 15-й экзон, при этом 80% всех мутаций в данном гене приходится <...> Были сформулированы основные клинические характеристики данной группы больных. 1) Мутации в гене BRAF <...> Мутации в генах как BRAF, так и NRAS обнаруживают почти в 95% врожденных невусов [27]. <...> каскада путем возникновения мутаций в генах BRAF и NRAS не является достаточной для злокачественной

16

ОПРЕДЕЛЕНИЕ РЕДКИХ МУТАЦИЙ ПРИ РУТИННОМ АНАЛИЗЕ ОНКОГЕНОВ KRAS, NRAS И BRAF [Электронный ресурс] / Михайленко [и др.] // Бюллетень экспериментальной биологии и медицины .— 2016 .— №9 .— С. 99-102 .— Режим доступа: https://rucont.ru/efd/579685

Автор: Михайленко

Проведен молекулярно-генетический анализ генов KRAS, NRAS и BRAF для определения оптимального алгоритма выявления минорных мутаций. Анализировали 35 образцов меланом и 33 — колоректального рака. В KRAS обнаружены частые мутации G12D/ V/A/C/S. Большинство мутаций BRAF в меланомах составляла мутация V600E, доля редких мутаций была существенна для ДНК-диагностики (24%). Идентификация редких мутаций BRAF 1790CG (L597R), 1798_1799delinsAA (V600K), 1798_1799delinsAG (V600R) и 1799_1800delinsAA (V600E), а также 38GT (G13V) NRAS была возможна лишь с применением секвенирования по Сэнгеру. Для повышения чувствительности теста и соответствия локусов международным рекомендациям целесообразно комбинировать ПЦР в реальном времени и секвенирование

В качестве примера можно привести тестирование мутаций в генах семейст� ва RAS и мутаций BRAF при КРР <...> Проводили ПЦР участков генов KRAS, NRAS, BRAF с праймерами, фланкирующими эк� зоны (таблица). <...> При исследовании гена BRAF в меланомах 76.2% (16/21) составляла частая му� тация с.1799ТG (p.V600E), <...> Точная идентификация редких мутаций в гене BRAF c.1790CG (p.L597R), c.1798_1799delinsAA (p.V600K), c <...> Секвенирование редких мутаций в генах BRAF и NRAS.

17

ТАРГЕТНАЯ ТЕРАПИЯ МЕЛАНОМЫ ВУЛЬВЫ С УЧЕТОМ РЕЗУЛЬТАТОВ ГЕНЕТИЧЕСКОГО ИССЛЕДОВАНИЯ [Электронный ресурс] / Коржевская [и др.] // Российский онкологический журнал .— 2015 .— №6 .— С. 32-35 .— Режим доступа: https://rucont.ru/efd/389706

Автор: Коржевская

В статье описаны два клинических наблюдения пациенток с онкологически отягощенным анамнезом, у которых была диагностирована меланома вульвы. В биопсийном материале у обеих пациенток с помощью специфичной ПЦР была обнаружена мутация в экзоне 11 гена KIT при отсутствии мутаций в гене BRAF. Отмечена положительная динамика в ответ на терапию тирозинкиназным ингибитором иматинибом (Гливек). В процессе дальнейшего лечения у одной из пациенток в метастатически измененном паховом лимфатическом узле была обнаружена минорная мутация гена NRAS, что свидетельствует о молекулярной неоднородности меланомы вульвы как одной из причин приобретенной резистентности к таргетной терапии.

KIT при отсутствии мутаций в гене BRAF. <...> NRAS и амплификаций гена KIT при отсутствии мутаций гена BRAF. <...> ПЦР-анализ опухолевой ДНК не выявил мутаций в экзонах 2, 3 гена NRAS и в экзоне 15 гена BRAF, но была <...> ПЦР-анализ не выявил мутаций в экзонах 2, 3 гена NRAS и в экзоне 15 гена BRAF, однако была обнаружена <...> KIT, мутации в гене BRAF не выявлены.

18

Ассоциация мутационного статуса гена BRAF с клиникоморфологическими особенностями меланомы кожи [Электронный ресурс] / Водолажский [и др.] // Евразийский онкологический журнал .— 2016 .— №2 .— С. 141-141 .— Режим доступа: https://rucont.ru/efd/479331

Автор: Водолажский

Мутации в гене BRAF наблюдаются в 40–80% случаев меланомы кожи и являются важными предикторами использования таргетных препаратов. На сегодняшний день известно около 40 соматических мутаций в гене BRAF. В связи с этим большой интерес представляет изучение связи клинико-морфологических особенностей меланомы кожи в зависимости от мутационного статуса гена BRAF.

BRAF с клиникоморфологическими особенностями меланомы кожи Мутации в гене BRAF наблюдаются в 40–80% <...> На сегодняшний день известно около 40 соматических мутаций в гене BRAF. <...> Молекулярно-генетическое исследование 15-го экзона гена BRAF проведено методами прямого секвенирования <...> Установлена статистически достоверная связь (p<0,05) между наличием активирующей мутации V600 гена BRAF <...> ДНК по Сэнгеру и RT-ПЦР) нами установлены два варианта мутаций в 15-м экзоне гена BRAF: p.V600E и p.V600K

19

№2 [Архив патологии, 2019]

Журнал основан в 1935 году, является одним из старейших периодических медицинских изданий в России. В нем публикуются оригинальные исследования по актуальным вопросам патологической анатомии и общей патологии, освещающие важнейшие положения теории и практики различных болезней человека (онкология, инфекционные болезни, заболевания сердца и сосудов, нефропатология, профессиональная патология, гастроэнтерология и др.), а также экспериментальной и географической патологии. Для ознакомления широкого круга читателей с новейшими достижениями отечественной и зарубежной медицины регулярно публикуются передовые и обзорные статьи, рецензии на наиболее интересные отечественные и зарубежные книги, новые данные о современных методах исследования в морфологии и молекулярной биологии (иммуногистохимия, электронная микроскопия, полимеразная цепная реакция и др.). Освещаются вопросы организации патологической службы, преподавания патологической анатомии. Регулярно печатаются статьи по истории патологической анатомии, помещаются отчеты о работе научных обществ патологоанатомов, сообщения о симпозиумах и совещаниях. Журнал рассчитан на патологоанатомов, патофизиологов, судебных медиков, а также клиницистов. Журнал входит в перечень изданий, утвержденных ВАК для публикаций материалов кандидатских и докторских диссертаций. Издание включено в Перечень автоматически, т.к. индексируется в международных базах данных.

Также выполнено генетическое исследование образцов на наличие мутаций гена KRAS и BRAF. Результаты. <...> При сравнении реакции маркеров и наличия мутаций в гене определено, что СЗА с мутацией гена BRAF интенсивно <...> BRAF +, абс. (%) KRAS +, абс. (%) BRAF/KRAS (без мутаций генов), абс. (%) СЗА 26 14 (53,8) 0 (0) 12 <...> BRAF в 38,5% случаев и гена KRAS в 15,4%, в 46,2% случаев отсутствовали мутации генов (см. табл. 1). <...> Однако для ГП выраженная реакция характерна для всех случаев (с мутацией и без генов BRAF и KRAS).

Предпросмотр: Архив патологии №2 2019.pdf (0,2 Мб)
20

Молекулярно-генетические маркеры как мишени таргетной терапии меланомы [Электронный ресурс] / Цыганова // Евразийский онкологический журнал .— 2015 .— №1 .— С. 30-31 .— Режим доступа: https://rucont.ru/efd/479002

Автор: Цыганова

Меланома отличается большой клинико-морфологической гетерогенностью и спектром молекулярно-генетических нарушений. В 70% меланомы кожи имеет место гиперактивация сигнального пути RAS-RAF-MEK-ERK, при этом могут быть активированы онкогены BRAF, NRAS, KIT.

BRAF. <...> BRAF c помощью ингибиторов MEK. <...> ЦЕЛЬ ИССЛЕДОВАНИЯ Характеристика мутаций генов BRAF, NRAS, KIT, PDGFRA, KRAS, GNAQ, GNA11 в меланомах <...> BRAF. <...> ЦЕЛЬ ИССЛЕДОВАНИЯ Характеристика мутаций генов BRAF, NRAS, KIT, PDGFRA, KRAS, GNAQ, GNA11 в меланомах

21

№6 [Молекулярная медицина, 2020]

Включен в перечень ВАК.

) при меланоме кожи, стало открытие мутации в гене BRAF. <...> посредники, к таким генам относятся гены BRAF и гены семейства RAS. <...> После выделения ДНК все пациенты были протипированы на точечные мутации в гене BRAF и генах семейства <...> С помощью МОЭ были созданы три генетические панели для детекции точечных мутаций в гене BRAF и генах <...> Было создано три панели для детекции мутаций в генах BRAF и генах семейства RAS.

Предпросмотр: Молекулярная медицина №6 2020.pdf (0,1 Мб)
22

№2 [Клиническая и экспериментальная тиреоидология, 2011]

Современнные проблемы клинической и экспериментальной тиреоидологии: этиология, патогенез, принципы диагностики, лечения и профилактики заболеваний щитовидной железы

BRAF) и дорожка 2 (амплифика� ция с праймерами только для мутантного типа гена BRAF). <...> Дорожки 1, 2, 3, 4 – “дикий” и мутантный тип гена BRAF. <...> У всех 4 пациентов (I–IV) присутствует “дикий” тип гена BRAF (внутренний контроль). <...> Дорожки 5, 6, 7, 8 – мутант� ный тип гена BRAF. <...> Пациенты II и IV – положительные по мутации в гене BRAF, I и III – отрицательные по мута� ции в гене

Предпросмотр: Клиническая и экспериментальная тиреоидология №2 2011.pdf (0,5 Мб)
23

№1 [Российский онкологический журнал, 2017]

Основан в 1996 г. Главный редактор журнала - Лазарев Александр Федорович - доктор медицинский наук, профессор, директор Алтайского филиала ФГБУ «Российский онкологический научный центр им. Н.Н.Блохина» Минздрава России. В оригинальных и обзорных статьях журнал освещает современные научные достижения в области клинической и экспериментальной онкологии, практические проблемы диагностики, комбинированного и комплексного лечения злокачественных новообразований, вопросы научной организации противораковой борьбы, опыта работы практических онкологических учреждений. Публикует данные о внедрении научных достижений в практику и обмен опытом. Информирует о состоянии науки за рубежом, печатает статьи, обзоры, обобщающие научные данные по важнейшим теоретическим и практическим проблемам, истории онкологии, хронику.

Проводился анализ образцов на наличие 7 мутаций гена KRAS, 4 мутаций гена PIK3CA, мутации BRAF V600E <...> Мутации в генах KRAS, PIK3CA не выявлены. Мутация V600E в гене BRAF выявлена в 50 (75%)случаях. <...> Val600Glu в гене BRAF выявлена в 50 (75%) случаях. <...> активности до 5,4% составило 81 ± 7,2%, а при диком типе гена BRAF – 44 ± 28,7%. <...> Val600Glu (V600E) гена BRAF при ПРЩЖ в Алтайском крае составила 75%. Мутации KRAS (p. Gly12Cys, p.

Предпросмотр: Российский онкологический журнал №1 2017.pdf (1,0 Мб)
24

Исследование экспрессии генов интегриновых рецепторов и их лигандов в тканях папиллярной карциномы щитовидной железы с различным статусом мутации BRAF V600E [Электронный ресурс] / Логачева // Евразийский онкологический журнал .— 2015 .— №1 .— С. 29-30 .— Режим доступа: https://rucont.ru/efd/479001

Автор: Логачева

Папиллярный рак щитовидной железы (ПРЩЖ) – наиболее частое злокачественное новообразование органов эндокринной системы. Самым распространенным генетическим повреждением при ПРЩЖ является мутация BRAF V600E, которая приводит к изменению активности внутриклеточных сигнальных путей

ЦЕЛЬ ИССЛЕДОВАНИЯ Оценить профиль экспрессии генов интегринов ITGA3, ITGAV, ITGA6, ITGA9, ITGB1 и их <...> В образцах ПРЩЖ BRAF V600E+ уровень экспрессии ITGA3 и ITGAV достоверно выше, чем в образцах BRAF V600E <...> BRAF. <...> BRAF c помощью ингибиторов MEK. <...> ЦЕЛЬ ИССЛЕДОВАНИЯ Характеристика мутаций генов BRAF, NRAS, KIT, PDGFRA, KRAS, GNAQ, GNA11 в меланомах

25

Изучение взаимосвязи мутации BRAF V600E с биомолекулярными и клинико-морфологическими характеристиками при папиллярном раке щитовидной железы [Электронный ресурс] / Иванов // Евразийский онкологический журнал .— 2016 .— №2 .— С. 362-362 .— Режим доступа: https://rucont.ru/efd/479758

Автор: Иванов

Цель: определение частоты мутаций в генах BRAF, KRAS, Pi3k при папиллярном раке щитовидной железы (ПРЩЖ) и выявление ассоциации данных генетических повреждений с клинико-патологическими и биомолекулярными характеристиками.

Блохина Министерства здравоохранения Российской Федерации, Барнаул, Россия Изучение взаимосвязи мутации BRAF <...> Определение мутаций в генах проводили методом Real-time-PCR. <...> Мутация BRAF V600E выявлена в 50 случаях (75%). <...> Амплификации гена Her2 не было выявлено ни в одном случае, но при наличии мутации V600E копийность гена <...> Частота мутации V600E гена BRAF составила 75%.

26

№6 [Российский онкологический журнал, 2015]

Основан в 1996 г. Главный редактор журнала - Лазарев Александр Федорович - доктор медицинский наук, профессор, директор Алтайского филиала ФГБУ «Российский онкологический научный центр им. Н.Н.Блохина» Минздрава России. В оригинальных и обзорных статьях журнал освещает современные научные достижения в области клинической и экспериментальной онкологии, практические проблемы диагностики, комбинированного и комплексного лечения злокачественных новообразований, вопросы научной организации противораковой борьбы, опыта работы практических онкологических учреждений. Публикует данные о внедрении научных достижений в практику и обмен опытом. Информирует о состоянии науки за рубежом, печатает статьи, обзоры, обобщающие научные данные по важнейшим теоретическим и практическим проблемам, истории онкологии, хронику.

KIT при отсутствии мутаций в гене BRAF. <...> NRAS и амплификаций гена KIT при отсутствии мутаций гена BRAF. <...> ПЦР-анализ опухолевой ДНК не выявил мутаций в экзонах 2, 3 гена NRAS и в экзоне 15 гена BRAF, но была <...> ПЦР-анализ не выявил мутаций в экзонах 2, 3 гена NRAS и в экзоне 15 гена BRAF, однако была обнаружена <...> KIT, мутации в гене BRAF не выявлены.

Предпросмотр: Российский онкологический журнал №6 2015.pdf (2,0 Мб)
27

№3 [Вестник дерматологии и венерологии, 2020]

"Вестник дерматологии и венерологии"- научно-практический рецензируемый медицинский журнал, основанный в 1924 году. На протяжении своего существования - журнал был и остается одним из важнейших источников достоверной и современной информации для специалистов в области дерматовенерологии и смежных дисциплин. "Вестник дерматологии и венерологии" включен в перечень изданий ВАК, рекомендованных для публикации статей, содержащих материалы диссертаций. "Вестник дерматологии и венерологии" публикует рецензируемые статьи по всем аспектам заболеваний кожи и инфекций передаваемых половым путем, косметологии, в том числе оригинальные клинические исследования, экспериментальные исследования с клинической значимостью, обзорные статьи, а также описания клинических случаев. Сегодня "Вестник дерматологии и венерологии" является старейшим российским рецензируемым и цитируемым научно-практическим изданием, освещающим наиболее важные и значимые достижения отечественной и мировой дерматовенерологии, организации здравоохранения, иммунологии, биологии и других важных фундаментальных и прикладных направлений медицины.

Особый акцент сделан на важных нюансах генно-инженерной биологической терапии: явлении иммуногенности <...> С появлением в арсенале дерматологов генно-инженерных биологических препаратов началась новая эпоха в <...> Ключевые слова: псориаз, системная терапия, генно-инженерные биологические препараты, малые молекулы. <...> После отсоединения от JAK и транслокации в ядро STAT-белки активируют гены, ответственные за продукцию <...> BRAF V600E [19].

Предпросмотр: Вестник дерматологии и венерологии №3 2020.pdf (12,3 Мб)
28

Роль функциональных характеристик стромальных клеток костного мозга реципиента в посттрансплантационной реконституции гемопоэза [Электронный ресурс] / Бархатов [и др.] // Евразийский онкологический журнал .— 2016 .— №2 .— С. 362-363 .— Режим доступа: https://rucont.ru/efd/479759

Автор: Бархатов

Целью данного исследования является изучение роли функциональных характеристик стромальных клеток костного мозга в процессе приживления донорского костного мозга и их значения в развитии осложнений после ТГСК

Блохина Министерства здравоохранения Российской Федерации, Барнаул, Россия Изучение взаимосвязи мутации BRAF <...> BRAF, KRAS, Pi3k при папиллярном раке щитовидной железы (ПРЩЖ) и выявление ассоциации данных генетических <...> Мутация BRAF V600E выявлена в 50 случаях (75%). <...> Амплификации гена Her2 не было выявлено ни в одном случае, но при наличии мутации V600E копийность гена <...> Частота мутации V600E гена BRAF составила 75%.

29

Динамика компонентов системы матриксных металлопротеиназ – тканевых ингибиторов металлопротеиназ при лечении хронической сердечной недостаточности. [Электронный ресурс] / Горшкова, Егорова, Пустовалова // Клиническая лабораторная диагностика .— 2016 .— №9 .— С. 13-14 .— Режим доступа: https://rucont.ru/efd/486937

Автор: Горшкова

Особенности функционирования системы матриксных металлопротеиназ – тканевых ингибиторов металлопротеиназ (ММР-TIMP), регулирующей процессы ремоделирования экстрацеллюлярного матрикса различных тканей, в настоящее время активно исследуется при изучении патогенеза сердечно-сосудистых заболеваний, в частности хронической сердечной недостаточности

Для нормализации результатов ПЦР использовали ген GAPDH. <...> Определение мутаций в генах BRCA, BRAF и KRAS осуществлялось методом аллель-специфичной ПЦР в режиме <...> Исследовали следующие мутации: в гене BRCA1 – 5382insC, 4153delA, 185delAG, T300G; в гене BRCA2 – 6174delT <...> ; в гене KRAS – G12C, G12S, G12R, G12V, G12D, G12A, G13D и V600E гена BRAF. <...> BRAF.

30

№4 [Российский онкологический журнал, 2017]

Основан в 1996 г. Главный редактор журнала - Лазарев Александр Федорович - доктор медицинский наук, профессор, директор Алтайского филиала ФГБУ «Российский онкологический научный центр им. Н.Н.Блохина» Минздрава России. В оригинальных и обзорных статьях журнал освещает современные научные достижения в области клинической и экспериментальной онкологии, практические проблемы диагностики, комбинированного и комплексного лечения злокачественных новообразований, вопросы научной организации противораковой борьбы, опыта работы практических онкологических учреждений. Публикует данные о внедрении научных достижений в практику и обмен опытом. Информирует о состоянии науки за рубежом, печатает статьи, обзоры, обобщающие научные данные по важнейшим теоретическим и практическим проблемам, истории онкологии, хронику.

Исследования мутаций гена EGFR при аденогенном раке лёгкого и мутаций генов KRAS, BRAF и BRCA1/2 при <...> Для этой формы рака характерны в 19% наличие соматических мутаций в гене KRAS и в 8% – в гене BRAF [7 <...> Оценивали статус генов EGFR, BRCA 1/2, KRAS, BRAF. <...> ; в гене KRAS – G12C, G12S, G12R, G12V, G12D, G12A, G13D и в гене BRAF – V600E. <...> 62,5% случаев, гена BRAF – в 12,5% наблюдений. 5.

Предпросмотр: Российский онкологический журнал №4 2017.pdf (1,0 Мб)
31

№2 [Вопросы биологической медицинской и фармацевтической химии, 2017]

журнал

Наиболее часто определяются точечные мутации в генах BRAF (50‒70%) и NRAS (15‒30%), которые являются <...> Считается, что сначала мутирует ген BRAF, затем повреждается PTEN/AKT-путь. <...> Однако единой стратегии для лечения меланомы с диким типом гена BRAF пока нет. <...> Как и в случае с мутацией в гене KIT, частота мутаций в генах NRAS и BRAF различается в зависимости от <...> Показано, что частота соматических мутаций в 11-м и 15-м экзонах гена BRAF и в 1-м и 2-м экзонах гена

Предпросмотр: Вопросы биологической медицинской и фармацевтической химии №2 2017.pdf (0,2 Мб)
32

Дифференциальная диагностика метастазов рака яичников с использованием цитологического, иммуноцитохимического методов и молекулярно-генетических исследований. [Электронный ресурс] / Григорук [и др.] // Клиническая лабораторная диагностика .— 2016 .— №9 .— С. 14-15 .— Режим доступа: https://rucont.ru/efd/486938

Автор: Григорук

Проблема диагностики метастазов рака яичника сложна и чрезвычайно актуальна. Даже при наличии диссеминации метастазов в брюшной полости клиника заболевания носит «стертый» характер, до 80% случаев рак яичника диагностируется на III–IV стадиях болезни. В диагностическом алгоритме обследования пациенток с подозрением на рак яичников цитологический метод диагностики выполняет немаловажное значение.

Определение мутаций в генах BRCA, BRAF и KRAS осуществлялось методом аллель-специфичной ПЦР в режиме <...> Исследовали следующие мутации: в гене BRCA1 – 5382insC, 4153delA, 185delAG, T300G; в гене BRCA2 – 6174delT <...> ; в гене KRAS – G12C, G12S, G12R, G12V, G12D, G12A, G13D и V600E гена BRAF. <...> BRAF. <...> Геном опухоли low grade карциномы относительно устойчив.

33

ОСОБЕННОСТИ АНГИОГЕНЕЗА У БОЛЬНЫХ МЕЛАНОМОЙ КОЖИ, ИМЕЮЩИХ РАЗЛИЧНЫЙ BRAF-СТАТУС [Электронный ресурс] / Аксененко, Рукша // Российский журнал кожных и венерических болезней .— 2017 .— №1 .— С. 6-11 .— Режим доступа: https://rucont.ru/efd/594405

Автор: Аксененко

Неоангиогенез имеет большое значение в развитии и прогрессии опухолевого процесса. Образование новых сосудов опухолью необходимо для ее дальнейшего роста и последующего метастазирования. Выраженность ангиогенеза зависит от баланса проангиогенных и антиангиогенных факторов Одним из таких ангиогенных факторов является матриксная металлопротеиназа-9 (ММП-9), фермент семейства эндопептидаз, принимающий участие в деградации межклеточного матрикса и ремоделировании сосудов. При этом известно, что мутация BRAF V600E может оказывать влияние на экспрессию проангиогенных факторов в опухолевой ткани. Цель исследования – изучение плотности микроциркуляторного русла в опухоли и перитуморальной зоне у пациентов с меланомой кожи, имеющих различный BRAF-статус, при помощи подсчета CD31-позитивно окрашенных клеток эндотелия сосудов, а также определение экспрессии ММП-9 в опухоли и клетках микроокружения, с последующим анализом наличия взаимосвязи между данными показателями. Материалом для исследования послужили 57 образцов опухолевого материала, полученных от пациентов с меланомой кожи. В результате исследования было выявлено, что при BRAF-позитивной лентиго-меланоме наблюдалась тенденция к увеличению васкуляризации в 2 раза, чем у BRAF-негативных больных лентиго-меланомой. Было выявлено изменение уровня васкуляризации в зависимости от локализации первичной опухоли: уровень васкуляризации был статистически выше у BRAF-позитивных пациентов с локализацией опухоли на коже туловища (p < 0,05), при этом не было выявлено значимых различий по другим важным морфологическим показателям, таким как изъязвление опухоли, выраженность лимфоцитарной инфильтрации и толщина опухоли по Бреслоу (p > 0,05). В данной работе не выявлено статистически значимых различий в экспрессии ММП-9 в зависимости от BRAF-статуса, как в опухолевых клетках, так и в клетках окружающей стромы (p > 0,05). Тем не менее, была выявлена тенденция к увеличению экспрессии ММП-9 в клетках окружающей стромы: в фибробластах, лимфоцитах, эндотелиальных клетках, полиморфно-ядерных лейкоцитах, независимо от BRAF-статуса. Несмотря на некоторые особенности опухолевого ангиогенеза при меланоме кожи у пациентов, имеющих различный BRAF-статус, ангиогенез в опухоли находится под влиянием различных ангиогененных и проангиогенных стимулов, которые имеют общие закономерности независимо от BRAF-статуса.

Мутация гена BRAF определяется в 40–60% меланом, преобладая среди опухолей, расположенных на закрытых <...> Образец ДНК считали отрицательным (нет мутации или мутировано менее 1% ДНК-копий гена BRAF), если dCtобразец <...> Вид меланомы BRAF + BRAF – p Поверхностно распространяющаяся меланома 8,9 9,0 0,99 Узловая меланома <...> Локализация BRAF + BRAF – p Голова, шея 7,1 13,2 0,53 Туловище 10,4 6,0 0,04 Верхние конечности 13,3 <...> БИБКОМ» & ООО «Aгентство Kнига-Cервис» 9 RUSSIAN JOURNAL of SKIN and VENEREAL DISEASES. 2017; 20(1) генная

34

Обзор лекарственных средств [Электронный ресурс] / Воронов // Рецепт .— 2013 .— №1 .— С. 5-8 .— Режим доступа: https://rucont.ru/efd/499699

Автор: Воронов

Мелоксикам-ФТ (МНН – мелоксикам) Мелоксикам является нестероидным противовоспалительным средством (НПВС), относится к производным эноловой кислоты, оказывает противовоспалительное, обезболивающее и жаропонижающее действие. Выраженное противовоспалительное действие мелоксикама установлено на всех стандартных моделях воспаления. Механизм действия мелоксикама состоит в его способности ингибировать синтез простагландинов – известных медиаторов воспаления.

Вемурафениб не рекомендуется для применения у больных меланомой при отсутствии мутаций в гене BRAF. <...> V600, выявленными при помощи диагностического теста Сobas 4800 BRAF V600 Mutation Test. <...> Регистрация препарата является важным событием для больных метастатической меланомой с мутациями BRAF <...> Белок BRAF – ключевой элемент сигнального пути RAS-RAF, обеспечивающий рост и существование клеток. <...> Мутации в гене BRAF вызывают гиперактивацию этого пути, что может привести к чрезмерной пролиферации

35

АНАЛИЗ ЧАСТОТЫ МУТАЦИЙ ГЕНОВ NRAS И c-Kit У БОЛЬНЫХ BRAF-НЕГАТИВНОЙ МЕЛАНОМОЙ КОЖИ [Электронный ресурс] / Аксененко, Комина, Рукша // Российский журнал кожных и венерических болезней .— 2016 .— №6 .— С. 6-9 .— Режим доступа: https://rucont.ru/efd/560126

Автор: Аксененко

Идентификация молекулярных подтипов меланомы позволила применять персонализированные подходы в терапии меланомы кожи. Одной из наиболее часто встречающихся драйверных мутаций при меланоме являются мутации онкогена BRAF, определяющиеся в 40–60% всех меланом. Вместе с тем, BRAFнегативные опухоли требуют дальнейшего исследования мутационного статуса, что может быть применено не только для выбора средств индивидуализированной терапии опухоли, но также для прогнозирования течения заболевания. В данной статье представлен анализ у 37 больных меланомой кожи с негативным BRAF-статусом на наличие мутаций в генах NRAS и c-Kit. Выявлено наличие мутаций в 3-м экзоне гена NRAS в 8,1% случаев. В 64,7% в меланомах кожи были определены «молчащие» мутации, что подтверждает возникновение выраженного мутационного процесса под воздействием ультрафиолетового излучения на кожу пациента. В последующем определены клинико-морфологические особенности пациентов, имеющих NRAS-мутации в 3-м экзоне. Данная группа больных характеризуется большей толщиной опухоли по Бреслоу, среди клинических характеристик у данной группы пациентов преобладал женский пол и более старший возраст, чем у больных, не имеющих NRAS-мутации (p < 0,05).

АНАЛИЗ ЧАСТОТЫ МУТАЦИЙ ГЕНОВ NRAS И c-Kit У БОЛЬНЫХ BRAF-НЕГАТИВНОЙ МЕЛАНОМОЙ КОЖИ ГБОУ ВПО Красноярский <...> Анализ частоты мутаций генов NRAS и c-Kit у пациентов с BRAF-негативной меланомой кожи. <...> В 50–70% случаев мутация в гене BRAF происходит в 600-м кодоне 15-го экзона [6]. <...> и 576-м кодоне 11-го экзона гена c-Kit у больных меланомой кожи с негативным BRAF-статусом. <...> У 26,7% пациентов, имеющих отрицательный BRAF-статус, не выявлено мутаций ни в гене NRAS, ни в гене c-Kit

36

ИПИЛИМУМАБ В ЛЕЧЕНИИ МЕТАСТАТИЧЕСКОЙ МЕЛАНОМЫ [Электронный ресурс] / Самойленко, Харкевич, Демидов // Медицинский совет .— 2016 .— №10 .— С. 86-94 .— Режим доступа: https://rucont.ru/efd/458584

Автор: Самойленко

Метастатическая меланома остается заболеванием, трудно поддающимся лечению. Большой прогресс в лечении пациентов с метастатической меланомой был достигнут за последние пять лет. Принципиально новым направлением в лекарственной терапии опухолей стала таргетная иммунотерапия – избирательное воздействие на сигнальные молекулы лимфоцитов. Ипилимумаб – первый препарат данного класса, который продемонстрировал клиническую эффективность у больных метастатической меланомой. В данной статье приводится обзор наиболее актуальных данных международных исследований и собственный клинический опыт применения ипилимумаба у больных метастатической меланомой

клиническом состоянии пациента, распространенности заболевания, наличии или отсутствии активирующих мутаций в генах <...> BRAF, CKIT. <...> связанных с механизмом действия. ■ Эффект развивается вне зависимости от наличия или отсутствия мутаций в гене <...> BRAF. ■ Не существует биомаркеров, которые могли бы предсказывать эффект. ■ Исследования показывают,

37

№5 [Бюллетень экспериментальной биологии и медицины, 2020]

В журнале помещаются плановые работы научно-исследовательских учреждений в виде кратких оригинальных сообщений по актуальным вопросам биологии и медицины, содержащие новые существенные научные результаты. Главный редактор академик РАН В.П. Чехонин. Рубрики журнала “Бюллетень экспериментальной биологии и медицины”: - Физиология - Общая патология и патологическая физиология - Биофизика и биохимия - Фармакология и токсикология - Новые лекарственные препараты - Иммунология и микробиология - Аллергология - Генетика - Вирусология - Онкология - Экология - Нанотехнологии - Новые биомедицинские технологии - Экспериментальные методы - клинике - Биогеронтология - Приматология - Спортивная медицина - Экспериментальная биология - Морфология и патоморфология - Методики.

Оценивали диагностическую значимость сома� тических мутаций в “горячих точках” генов BRAF, KRAS, NRAS <...> Мутации в гене BRAF (экзон 15, район кодонов 600�601) были обнаружены у 54 пациентов, в гене NRAS (экзон <...> Ключевые слова: новообразования щитовидной железы; мутации генов BRAF, KRAS, NRAS, EIF1AX, TERT Адрес <...> Мутации гена BRAF в 53 случаях гистологичес� ки были представлены папиллярным РЩЖ. <...> В одном случае мутация гена BRAF была вы� явлена у пациента с узловым коллоидным зобом, что является

Предпросмотр: Бюллетень экспериментальной биологии и медицины №5 2020.pdf (0,1 Мб)
38

РОЛЬ СПЛЕНЭКТОМИИ В ЛЕЧЕНИИ ОСТРОЙ ДЫХАТЕЛЬНОЙ НЕДОСТАТОЧНОСТИ У БОЛЬНОЙ ВОЛОСАТОКЛЕТОЧНЫМ ЛЕЙКОЗОМ [Электронный ресурс] / Галстян [и др.] // Гематология и трансфузиология .— 2017 .— №1 .— С. 55-58 .— Режим доступа: https://rucont.ru/efd/594173

Автор: Галстян

Представлено клиническое наблюдение за больной волосатоклеточным лейкозом (ВКЛ), у которой заболевание манифестировало двусторонней пневмонией на фоне опухолевого агранулоцитоза с развитием выраженной острой дыхательной недостаточности (ОДН), потребовавшей перевода больной на искусственную вентиляцию легких. Регресс ОДН и положительная динамика в течении пневмонии были достигнуты в результате спленэктомии, после которой нормализовалось число гранулоцитов крови, а также после назначения вориконазола. Проведение торакоскопической биопсии легкого не позволило выявить патогены, только после выполнения повторного бронхоальвеолярного лаважа удалось установить этиологическую причину поражения легких: грибы рода Aspergillus. Наличие мутации в гене BRAF V600E позволило начать терапию ингибитором BRAF-киназы вемурафенибом. В отличие от терапии цитостатическими препаратами это позволило избежать снижения лейкоцитов и прогрессию инфекционных осложнений В последующем, через 4 мес у больной была достигнута клинико-гематологическая ремиссия заболевания.

Наличие мутации в гене BRAF V600E позволило начать терапию ингибитором BRAF-киназы вемурафенибом. <...> В лимфоцитах периферической крови выявлена гетерозиготная мутация гена BRAF, приводящая к аминокислотной <...> BRAF-V600E mutation was searched out. <...> Исследование лимфоцитов периферической крови выявило у больной мутацию гена BRAFV600E. <...> BRAF-V600E mutation in hairy cell leukemia: from bench to bedside.

39

№2 [Практическая онкология, 2012]

В журнале освещаются вопросы эпидемиологии, этиологии, диагностики, профилактики и лечения некоторых наиболее часто встречающихся опухолей. Авторы - прогрессивные ученые-онкологи, развивающие современную онкологическую науку и имеющие серьезный практический опыт в лечении онкологический заболеваний. Каждый выпуск журнала освещает конкретно определенную тему, по которой публикуются как специализированные статьи и лекции, клинические наблюдения и обзоры литературы в области научных и практических исследований по клинической и экспериментальной онкологии так и материалы оригинальных работ,содержащих результаты диссертаций на соискание ученой степени доктора и кандидата медицинских наук

белка семейства RAS, повреждения гена BRAF приводят к автономной ак' тивации этой серин'треониновой <...> Мутации в гене BRAF наблюдаются преимущественно в новообразованиях, возникающих на необлучённых уча' <...> До недавнего времени считалось, что доминирующей мутацией в позиции 600 гена BRAF является замена валина <...> Абышевой за предоставление рисунков, отражающих примеры оп' ределения мутаций в генах BRAF и KIT. <...> , в первую очередь, в гене BRAF.

Предпросмотр: Практическая онкология №2 2012.pdf (0,2 Мб)
40

№2 [Эндокринная хирургия, 2012]

научно-практический журнал, издается 2007 г. Главный редактор - профессор, д.м.н. Кузнецов Н.С. Журнал Эндокринная хирургия - первое в России периодическое издание, посвященное проблемам диагностики и хирургического лечения различных заболеваний эндокринной системы. В данном научно-практическом издании рассматриваются медико-технические вопросы хирургических подходов к лечению не только эндокринных заболеваний, но и проблемы хирургического лечения осложнений сахарного диабета, в частности синдрома диабетической стопы, диабетической офтальмопатии и т.д.

RET/PTC rearrangements and BRAF mutations in thyroid tumorigenesis. <...> BRAF mutations in papillary thyroid carcinoma. <...> В последнее время доказана эффективность эластографии ЩЖ и анализа мутации гена BRAF в диагностике злокачест <...> BRAF. <...> Использование эластографии и анализа мутации гена BRAF при оценке уз� ловых образований ЩЖ могут привести

Предпросмотр: Эндокринная хирургия №2 2012.pdf (0,2 Мб)
41

№6 [Медицинский совет, 2017]

Профессиональный мультидисциплинарный журнал для практикующих врачей. Статьи в журнале сочетают в себе практическую информацию, клинические лекции и научные обзоры с новостями медицины. В каждом выпуске представлены основные тематические разделы по специальностям: терапия, педиатрия, аллергология, бронхопульмонология, гастроэнтерология гинекология, дерматовенерология, кардиология, психоневрология, ревматология, урология; информация по профессиональному усовершенствованию от лучших медицинских ВУЗов страны; новости, интервью и страничка для публикации работ диссертантов.

/MEK (в случае наличия мутации в гене BRAF). <...> г. изменил представления о возможностях терапии метастатической меланомы кожи с мутацией в гене BRAF <...> В связи с этим применение МИС вместо, вместе или последовательно у больных с мутацией в гене BRAF V600 <...> У пациентов с мутацией в гене BRAF общая выживаемость (рис. 4, нижний график) ни в одной из подгрупп <...> Подгрупповой анализ в исследовании KEYNOTE-001: у пациентов с мутацией в гене BRAF вероятность наступления

Предпросмотр: Медицинский совет №6 2017.pdf (0,3 Мб)
42

№1 [Клиническая и экспериментальная тиреоидология, 2018]

Современнные проблемы клинической и экспериментальной тиреоидологии: этиология, патогенез, принципы диагностики, лечения и профилактики заболеваний щитовидной железы

Определение мутации Т1799A (V600E) в гене BRAF проводили с помощью полимеразной цепной реакции (ПЦР) <...> Таким образом, при выявлении на дооперационном этапе мутации гена BRAF выполнение тиреоидэктомии с ЦЛД <...> 1 – наличие мутации гена BRAF; р = 0,0000494. <...> Данные нашего исследования позволяют предложить наличие мутации гена BRAF в качестве фактора высокого <...> Данный процесс обусловлен различными мутациями гена b-изоформы рецептора ТГ, в результате нарушается

Предпросмотр: Клиническая и экспериментальная тиреоидология №1 2018.pdf (0,2 Мб)
43

№1 [Российский журнал кожных и венерических болезней, 2016]

Основан в 1998 г. Главный редактор журнала - Иванов Олег Леонидович - доктор медицинских наук, член EASE, профессор кафедры кожных и венерических болезней им. В.А. Рахманова лечебного факультета ГБОУ ВПО Первый МГМУ им. И.М. Сеченова Минздрава России. В журнале освещаются проблемы дерматологии, венерологии, дерматоонкологии. Журнал использует различные формы подачи материала, выделены такие разделы, как: пиококковые заболевания кожи, микозы, дерматоонозы, пузырные дерматозы, дерматокосметология. Регулярно публикуется информация о новых книгах и руководствах по дерматовенерологии, вопросы тестового характера, клинические задачи и многое другое.

Мутации в гене BRAF затрагивают, как правило, 15-й экзон, при этом 80% всех мутаций в данном гене приходится <...> Были сформулированы основные клинические характеристики данной группы больных. 1) Мутации в гене BRAF <...> Мутации в генах как BRAF, так и NRAS обнаруживают почти в 95% врожденных невусов [27]. <...> каскада путем возникновения мутаций в генах BRAF и NRAS не является достаточной для злокачественной <...> Таким образом, выявление мутаций в генах BRAF и NRAS при врожденных и диспластических невусах, а также

Предпросмотр: Российский журнал кожных и венерических болезней №1 2016.pdf (0,5 Мб)
44

МОЛЕКУЛЯРНЫЕ ОСОБЕННОСТИ ФОЛЛИКУЛЯРНОГО ВАРИАНТА ПАПИЛЛЯРНОГО РАКА ЩИТОВИДНОЙ ЖЕЛЕЗЫ [Электронный ресурс] / Спирина, Чижевская, Кондакова // Бюллетень экспериментальной биологии и медицины .— 2020 .— №1 .— С. 93-96 .— Режим доступа: https://rucont.ru/efd/712371

Автор: Спирина

Молекулярные особенности фолликулярного варианта папиллярного рака щитовидной железы тесным образом сопряжены с “клиническим поведением” опухоли и прогнозом заболевания. Мутации BRAF-V600E у пациентов c фолликулярным вариантом папиллярного рака щитовидной железы не выявлены, однако большинство пациентов имело стадию T3-4N0M0. Выявлено изменение экспрессии транскрипционных, ростовых факторов и компонентами AKT/m-TOR сигнального пути. Кроме того, показана гиперкэспрессия киназ m-TOR, 4EBP1 и фермента CAIX, в отличие от классического варианта папиллярного РЩЖ, при котором наблюдалось повышение экспрессии ядерного фактора NF-κBp65 и киназы c-RAF

выявления точечной мутации GTG→GGG в 600�м кодоне гена BRAF. <...> В качестве референсного гена использовали ген GAPDH (glyceraldehyde�3�phosphate dehydroge� nase), уровень <...> экспрессии каждого целевого гена нормализовали по отношению к экспрессии GAPDH. <...> Резуль� таты определения экспрессии генов представлены в виде Me (Q1; Q3). <...> Известно, что мутации BRAF способны активировать ядерный фактор NF�κB [2].

45

№3 [Практическая онкология, 2014]

В журнале освещаются вопросы эпидемиологии, этиологии, диагностики, профилактики и лечения некоторых наиболее часто встречающихся опухолей. Авторы - прогрессивные ученые-онкологи, развивающие современную онкологическую науку и имеющие серьезный практический опыт в лечении онкологический заболеваний. Каждый выпуск журнала освещает конкретно определенную тему, по которой публикуются как специализированные статьи и лекции, клинические наблюдения и обзоры литературы в области научных и практических исследований по клинической и экспериментальной онкологии так и материалы оригинальных работ,содержащих результаты диссертаций на соискание ученой степени доктора и кандидата медицинских наук

Поскольку в спорадических ПРЩЖ сома� тические мутации в гене BRAF выявляются с высокой ча� стотой (40% <...> The T1799A BRAF mutation is not a germline mutation in familial nonmedullary thyroid cancer // Clin Endo <...> Если же в опу� холи выявляется МСН, вторым этапом проводится поиск соматической мутации в гене BRAF для <...> Если мутация в гене BRAF выявлена, такой рак счи� тается спорадическим, если же мутации в гене BRAF нет <...> BRAF screening as a low� cost effective strategy for simplifying HNPCC genetic testing // J. Med.

Предпросмотр: Практическая онкология №3 2014.pdf (0,2 Мб)
46

№4 [Российский онкологический журнал, 2013]

Основан в 1996 г. Главный редактор журнала - Лазарев Александр Федорович - доктор медицинский наук, профессор, директор Алтайского филиала ФГБУ «Российский онкологический научный центр им. Н.Н.Блохина» Минздрава России. В оригинальных и обзорных статьях журнал освещает современные научные достижения в области клинической и экспериментальной онкологии, практические проблемы диагностики, комбинированного и комплексного лечения злокачественных новообразований, вопросы научной организации противораковой борьбы, опыта работы практических онкологических учреждений. Публикует данные о внедрении научных достижений в практику и обмен опытом. Информирует о состоянии науки за рубежом, печатает статьи, обзоры, обобщающие научные данные по важнейшим теоретическим и практическим проблемам, истории онкологии, хронику.

низкодифференцированная карцинома – 2 (1,5%), злокачественная лимфома – 1 (0,72%). из 77 пациентов с ПРЩж мутации BRAF-гена <...> Таким образом, полученные данные свидетельствуют о том, что мутации в гене BRAF происходят только при <...> Среди всех форм РЩж мутации в гене BRAF наблюдались только при папиллярных карциномах. <...> Наличие мутации в гене BRAF можно использовать в качестве диагностического критерия РЩж, в частности <...> Выявление мутации в гене BRAF можно использовать при дифференциальной диагностике опухолей щитовидной

Предпросмотр: Российский онкологический журнал №4 2013.pdf (2,2 Мб)
47

№4 [Молекулярная генетика, микробиология и вирусология, 2017]

Основан в 1983 г. Главный редактор журнала - Костров Сергей Викторович - член-корреспондент РАН, профессор, доктор биологических наук, директор Института молекулярной генетики РАН. Журнал освещает наиболее актуальные теоретические и прикладные проблемы молекулярной генетики про- и эукариотных организмов, молекулярной микробиологии и молекулярной вирусологии. Важную роль журнал отводит исследованиям генетического аппарата микроорганизмов, изысканиям форм генетического обмена, генетического картирования патогенных возбудителей, выяснению строения и функций внехромосомных факторов наследственности и мигрирующих генетических элементов, теоретическим исследованиям механизмов генетической регуляции. Публикует результаты исследований молекулярных и генетических основ эукариотной клетки, функционирования хромосом и хроматина, природы генетических изменений при злокачественном перерождении и ряде наследственных заболеваний. На страницах журнала освещается разработка молекулярных основ вирусологии, в том числе вопросы интеграции вирусных и клеточных геномов, вопросы персистенции.

BRAF [4, 21]. <...> BRAF [23, 25]. <...> , BRAF-RAF1; а также точечная соматическая мутация V600e в гене BRAF, приводящие к устойчивой активации <...> BRAF [22, 23]. <...> в гене BRAF и fusion-мутации генов семейства NTRK относительно чаще встречаются при супратенториальных

Предпросмотр: Молекулярная генетика, микробиология и вирусология №4 2017.pdf (1,1 Мб)
48

№4 [Практическая онкология, 2012]

В журнале освещаются вопросы эпидемиологии, этиологии, диагностики, профилактики и лечения некоторых наиболее часто встречающихся опухолей. Авторы - прогрессивные ученые-онкологи, развивающие современную онкологическую науку и имеющие серьезный практический опыт в лечении онкологический заболеваний. Каждый выпуск журнала освещает конкретно определенную тему, по которой публикуются как специализированные статьи и лекции, клинические наблюдения и обзоры литературы в области научных и практических исследований по клинической и экспериментальной онкологии так и материалы оригинальных работ,содержащих результаты диссертаций на соискание ученой степени доктора и кандидата медицинских наук

Семейство ки� наз RAF представлено несколькими генами – ARAF, BRAF и CRAF. <...> белка семейства RAS, повреж� дения гена BRAF приводят к автономной активации этой серин�треониновой <...> Мутационный статус генов BRAF и KRAS находится в реципрокных взаимоотношениях: если в РТК обнаруживается <...> активация KRAS, присутствие нарушений в кодоне 600 гена BRAF практически исключено; напро� тив, если <...> Другую группу, о которой уже говорилось выше, составляют пожилые пациенты; мутации в гене BRAF наблюдаются

Предпросмотр: Практическая онкология №4 2012.pdf (0,2 Мб)
49

№3 [Клиническая и экспериментальная тиреоидология, 2019]

Современнные проблемы клинической и экспериментальной тиреоидологии: этиология, патогенез, принципы диагностики, лечения и профилактики заболеваний щитовидной железы

Развитие рака щитовидной железы, сопряженное с мутацией гена BRAF и активацией онкобелка RET, а также <...> В большинстве случаев данная патология связана с возникновением точечных мутаций гена BRAF (30–69%) и <...> Примерно такой же процент опухолей обусловлен мутациями гена BRAF (BRAFV600E), представителя семейства <...> BRAF [1]. <...> Targeting autophagy sensitizes BRAF-mutant thyroid cancer to vemurafenib.

Предпросмотр: Клиническая и экспериментальная тиреоидология №3 2019.pdf (1,0 Мб)
50

Диагностическое значение показателя коэнзима Q10 в крови у детей с митохондриальными заболеваниями [Электронный ресурс] / Николаева [и др.] // Российский вестник перинатологии и педиатрии .— 2015 .— №5 .— С. 71-75 .— Режим доступа: https://rucont.ru/efd/533279

Автор: Николаева

С целью установления диагностической значимости изменения показателя коэнзима Q10 проведено исследование его уровня в крови у 15 детей с митохондриальными заболеваниями (1-я группа). Группу сравнения составили 13 детей с нейродегенеративными заболеваниями (2-я группа). В контрольную группу вошли 29 здоровых детей аналогичного возраста. Средний уровень коэнзима Q10 в 1-й группе детей (0,56±0,06 мкмоль/л) не отличался от значений контрольной группы. Однако у этих пациентов было значительно снижено отношение коэнзим Q10/холестерин (0,10±0,01; р<0,001). У больных старшей возрастной подгруппы определялся достоверно более низкий уровень коэнзима Q10, что, по-видимому, отражает прогрессирующий характер патологии. Отмечена тенденция к снижению с возрастом отношения коэнзим Q10/холестерин. У детей 2-й группы выявлено более высокое содержание коэнзима Q10 в крови (1,53±0,23 мкмоль/л; р<0,001), чем в 1-й группе, и повышение отношения коэнзим Q10/холестерин (0,31±0,04 мкмоль/л; р<0,001). Рекомендуется продолжить исследования для установления обоснованности использования низких показателей коэнзима как дополнительного критерия дифференциальной диагностики митохондриальных болезней.

MVK), глутаровой ацидемией 2-го типа (ген ETFDH), атаксией-окуломоторной апраксией 1-го типа (ген ARTX <...> ), сердечно-кожно-лицевым синдромом (ген BRAF), атаксией Фридрейха (ген FXN), миодистрофией Дюшенна ( <...> ND1), у 2 – митохондриальная энцефаломиопатия с кардиомиопатией (ген MTTK), у 1 – синдром MELAS (ген <...> MTTL1), у 1 – синдром Ли (ген ND3). <...> развития (ген NDUFB9).

Страницы: 1 2 3 ... 1225